Transcript: Mouse XR_001785541.1

PREDICTED: Mus musculus HIRA interacting protein 3 (Hirip3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hirip3 (233876)
Length:
1900
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785541.1
NBCI Gene record:
Hirip3 (233876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121371 CCCGAAGTTGTTCATCTTCAT pLKO.1 1293 3UTR 100% 4.950 6.930 N Hirip3 n/a
2 TRCN0000121370 GCTTTAATTCAGAGTCAGAAT pLKO.1 306 3UTR 100% 4.950 6.930 N Hirip3 n/a
3 TRCN0000436895 ACCTCCAGACTGGTCCCATAT pLKO_005 1611 3UTR 100% 10.800 7.560 N Hirip3 n/a
4 TRCN0000428680 CAGAAGGGCCAGGTTAGAAAG pLKO_005 557 3UTR 100% 10.800 7.560 N Hirip3 n/a
5 TRCN0000430829 GAAAGCCAGACTTTATCAAAG pLKO_005 237 3UTR 100% 10.800 7.560 N Hirip3 n/a
6 TRCN0000438462 GGCTCTGTTAGATCAGGTAAG pLKO_005 503 3UTR 100% 6.000 4.200 N Hirip3 n/a
7 TRCN0000121369 CCTCAACAAAGAACAGGACAA pLKO.1 363 3UTR 100% 4.050 2.835 N Hirip3 n/a
8 TRCN0000415434 TGGTCAGTGGAAGCAACTTCC pLKO_005 1712 3UTR 100% 4.050 2.835 N Hirip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.