Transcript: Human XR_002956271.1

PREDICTED: Homo sapiens cullin 9 (CUL9), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUL9 (23113)
Length:
8104
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956271.1
NBCI Gene record:
CUL9 (23113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427037 AGCGGTTTCAGGACTATAATG pLKO_005 6913 3UTR 100% 13.200 18.480 N CUL9 n/a
2 TRCN0000429363 GCTCGTCTACTTCACGAAATC pLKO_005 1826 3UTR 100% 10.800 15.120 N CUL9 n/a
3 TRCN0000004450 GCAGGTTCTCAGTAGTCGATT pLKO.1 1728 3UTR 100% 4.950 3.960 N CUL9 n/a
4 TRCN0000004449 CCATCTTTCAGCCCTACATTT pLKO.1 1091 3UTR 100% 13.200 9.240 N CUL9 n/a
5 TRCN0000413352 AGCAGTTTGCCAGGTACATTG pLKO_005 4871 3UTR 100% 10.800 7.560 N CUL9 n/a
6 TRCN0000424584 GATCTCTGTGTCCGTGGAAAT pLKO_005 1692 3UTR 100% 10.800 7.560 N CUL9 n/a
7 TRCN0000004451 GCTGGAATGAGTACCTGACAA pLKO.1 6328 3UTR 100% 4.950 3.465 N CUL9 n/a
8 TRCN0000004448 TCTGTAGTGCTTCCTGTTTGC pLKO.1 8057 3UTR 100% 4.050 2.835 N CUL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.