Transcript: Human XR_002956307.1

PREDICTED: Homo sapiens family with sequence similarity 120B (FAM120B), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM120B (84498)
Length:
2977
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956307.1
NBCI Gene record:
FAM120B (84498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232822 CATGTGTACACACGCTGAAAT pLKO_005 1680 3UTR 100% 13.200 18.480 N FAM120B n/a
2 TRCN0000138722 GCTGTCGAAAGCCCATTTCAA pLKO.1 2251 3UTR 100% 5.625 7.875 N FAM120B n/a
3 TRCN0000257032 GGCGAGAAGTTCCCGTGTATA pLKO_005 1202 3UTR 100% 13.200 10.560 N FAM120B n/a
4 TRCN0000232823 GAGGATTTGCATGCGTTTATT pLKO_005 2326 3UTR 100% 15.000 10.500 N FAM120B n/a
5 TRCN0000232821 TAGCTGTGTCAGACCATATAT pLKO_005 911 3UTR 100% 15.000 10.500 N FAM120B n/a
6 TRCN0000138700 GCCTTCATTTACCGTCCCATT pLKO.1 1972 3UTR 100% 4.050 2.835 N FAM120B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.