Transcript: Human XR_002956802.1

PREDICTED: Homo sapiens AT-rich interaction domain 4B (ARID4B), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARID4B (51742)
Length:
5888
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956802.1
NBCI Gene record:
ARID4B (51742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236101 AGATAGAGGTACACCTATTAA pLKO_005 1426 3UTR 100% 15.000 21.000 N ARID4B n/a
2 TRCN0000363154 ACCTTAGGGTGGCTTTAATTG pLKO_005 4717 3UTR 100% 13.200 18.480 N ARID4B n/a
3 TRCN0000146353 CCTATTAACAAACGACCTGTA pLKO.1 1439 3UTR 100% 4.050 5.670 N ARID4B n/a
4 TRCN0000236100 TCGGAGGAGAAAGCGTTTAAA pLKO_005 4093 3UTR 100% 15.000 12.000 N ARID4B n/a
5 TRCN0000363511 GGAATCTAAGATTGATCATTT pLKO_005 2407 3UTR 100% 13.200 10.560 N ARID4B n/a
6 TRCN0000363140 AGTCAAGCACATGTAATAAAT pLKO_005 4742 3UTR 100% 15.000 10.500 N ARID4B n/a
7 TRCN0000111955 GCCAGTTCAAAGTGTATATTT pLKO.1 5039 3UTR 100% 15.000 10.500 N Arid4b n/a
8 TRCN0000236103 TGTACTTGGATATCGAAATTT pLKO_005 1456 3UTR 100% 15.000 10.500 N ARID4B n/a
9 TRCN0000236102 CAATACAGTAAGCATAGTTAA pLKO_005 4545 3UTR 100% 13.200 9.240 N ARID4B n/a
10 TRCN0000363428 TAGATGAATCCCTCAACATAA pLKO_005 1992 3UTR 100% 13.200 9.240 N ARID4B n/a
11 TRCN0000236099 TATCCGAAGATACTGATTATG pLKO_005 2571 3UTR 100% 13.200 9.240 N ARID4B n/a
12 TRCN0000146564 CCATAAAGCAACAGTGGTAAA pLKO.1 3724 3UTR 100% 10.800 7.560 N ARID4B n/a
13 TRCN0000146977 CGTGTCAGAATCCTTTACATT pLKO.1 5609 3UTR 100% 5.625 3.938 N ARID4B n/a
14 TRCN0000150229 GTAGATGAATCCCTCAACATA pLKO.1 1991 3UTR 100% 5.625 3.938 N ARID4B n/a
15 TRCN0000150300 CGCATCACAATTCTTCAAGAA pLKO.1 4013 3UTR 100% 4.950 3.465 N ARID4B n/a
16 TRCN0000147109 CTAGGCAAAGTTGTATGTGTA pLKO.1 980 3UTR 100% 4.950 3.465 N ARID4B n/a
17 TRCN0000147816 GCAATACAGAAGAGTGTCTAA pLKO.1 2688 3UTR 100% 4.950 3.465 N ARID4B n/a
18 TRCN0000149755 GCACTGATGTGAGTGCTAAAT pLKO.1 501 3UTR 100% 1.320 0.924 N ARID4B n/a
19 TRCN0000358800 ACTCTGATACTGCTCATATTA pLKO_005 2271 3UTR 100% 15.000 9.000 N ARID4B n/a
20 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1299 3UTR 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.