Transcript: Human XR_002956831.1

PREDICTED: Homo sapiens glyoxylate and hydroxypyruvate reductase (GRHPR), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRHPR (9380)
Length:
2293
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956831.1
NBCI Gene record:
GRHPR (9380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042333 CCATTCGGTGTCCAGAGATTT pLKO.1 254 3UTR 100% 13.200 18.480 N Grhpr n/a
2 TRCN0000232694 CCATTCGGTGTCCAGAGATTT pLKO_005 254 3UTR 100% 13.200 18.480 N GRHPR n/a
3 TRCN0000351551 CCATTCGGTGTCCAGAGATTT pLKO_005 254 3UTR 100% 13.200 18.480 N Grhpr n/a
4 TRCN0000232697 AGCAAACCGTGCCCTGGTATT pLKO_005 2110 3UTR 100% 10.800 8.640 N GRHPR n/a
5 TRCN0000232696 CCAGAACCACTGCCTACAAAC pLKO_005 1912 3UTR 100% 10.800 7.560 N GRHPR n/a
6 TRCN0000232695 CCTTGGCCAGTGGTAAGATTG pLKO_005 1865 3UTR 100% 10.800 7.560 N GRHPR n/a
7 TRCN0000046500 ACCCTGAAGAACTGTGTGATT pLKO.1 1945 3UTR 100% 4.950 3.465 N GRHPR n/a
8 TRCN0000046498 CGGTGTCCAGAGATTTCTGTA pLKO.1 259 3UTR 100% 4.950 3.465 N GRHPR n/a
9 TRCN0000046499 GCCTAGTGAACTCAAGCTGTA pLKO.1 2061 3UTR 100% 4.050 2.835 N GRHPR n/a
10 TRCN0000046502 CCTGCTCCTTAACACCTGCAA pLKO.1 378 3UTR 100% 2.640 1.848 N GRHPR n/a
11 TRCN0000046501 CATGTCCTTGTTGGCAGCTAA pLKO.1 2007 3UTR 100% 4.950 2.970 N GRHPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.