Transcript: Human XR_002957210.1

PREDICTED: Homo sapiens phosphatidylinositol transfer protein membrane associated 1 (PITPNM1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PITPNM1 (9600)
Length:
4370
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957210.1
NBCI Gene record:
PITPNM1 (9600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438037 TCCGGCTACCTGATCGTGTAT pLKO_005 3534 3UTR 100% 4.950 6.930 N PITPNM1 n/a
2 TRCN0000441337 AGTGGCGCATGCAGAACATTG pLKO_005 1221 3UTR 100% 10.800 7.560 N PITPNM1 n/a
3 TRCN0000029759 CCATTGAAATTGAGACCTATT pLKO.1 549 3UTR 100% 10.800 7.560 N PITPNM1 n/a
4 TRCN0000100733 CAGCTCTACATGATCCAGAAA pLKO.1 287 3UTR 100% 4.950 3.465 N Pitpnm1 n/a
5 TRCN0000332136 CAGCTCTACATGATCCAGAAA pLKO_005 287 3UTR 100% 4.950 3.465 N Pitpnm1 n/a
6 TRCN0000029760 GCCTATAAGCTGTGCAAGGTT pLKO.1 791 3UTR 100% 3.000 2.100 N PITPNM1 n/a
7 TRCN0000029762 CAAGGAGATGACCAAGTGGAA pLKO.1 1321 3UTR 100% 2.640 1.848 N PITPNM1 n/a
8 TRCN0000029763 CGTCACGCTCACTGGAGAGAA pLKO.1 3116 3UTR 100% 1.650 1.155 N PITPNM1 n/a
9 TRCN0000029761 GCCGGTTATGGGTCTCCCAAA pLKO.1 3723 3UTR 100% 1.350 0.810 N PITPNM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.