Transcript: Human XR_002957291.1

PREDICTED: Homo sapiens contactin 1 (CNTN1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTN1 (1272)
Length:
5768
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957291.1
NBCI Gene record:
CNTN1 (1272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073377 CCAAGGATCATCAGTTCAGTA pLKO.1 2939 3UTR 100% 4.950 6.930 N CNTN1 n/a
2 TRCN0000289922 CCAAGGATCATCAGTTCAGTA pLKO_005 2939 3UTR 100% 4.950 6.930 N CNTN1 n/a
3 TRCN0000073375 GCCGGAATGTATCAGTGCATA pLKO.1 1370 3UTR 100% 4.950 6.930 N CNTN1 n/a
4 TRCN0000289847 GCCGGAATGTATCAGTGCATA pLKO_005 1370 3UTR 100% 4.950 6.930 N CNTN1 n/a
5 TRCN0000073374 CCCGGTTTACAAATGGAGAAT pLKO.1 430 3UTR 100% 4.950 3.960 N CNTN1 n/a
6 TRCN0000289921 CCCGGTTTACAAATGGAGAAT pLKO_005 430 3UTR 100% 4.950 3.960 N CNTN1 n/a
7 TRCN0000073373 GCTCCATCCTAAGCCAAATAA pLKO.1 3481 3UTR 100% 15.000 10.500 N CNTN1 n/a
8 TRCN0000039015 GCAGCCAATCAATACCATTTA pLKO.1 349 3UTR 100% 13.200 9.240 N Cntn1 n/a
9 TRCN0000222544 GCCGTGGTTCAGACAATCATA pLKO.1 2088 3UTR 100% 5.625 3.938 N CNTN1 n/a
10 TRCN0000289920 GCCGTGGTTCAGACAATCATA pLKO_005 2088 3UTR 100% 5.625 3.938 N CNTN1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 74 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 74 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.