Transcript: Human XR_002957533.1

PREDICTED: Homo sapiens proline rich membrane anchor 1 (PRIMA1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRIMA1 (145270)
Length:
1737
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957533.1
NBCI Gene record:
PRIMA1 (145270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156923 GCAACAAAGGAGTAGACGTGA pLKO.1 1715 3UTR 100% 2.640 3.696 N PRIMA1 n/a
2 TRCN0000124745 CATTTGCTACAAAGCCATAAA pLKO.1 444 3UTR 100% 13.200 10.560 N Prima1 n/a
3 TRCN0000153698 CTGACTGTGCTTGTCATCATT pLKO.1 427 3UTR 100% 5.625 3.938 N PRIMA1 n/a
4 TRCN0000150493 GCTTGTCATCATTTGCTACAA pLKO.1 435 3UTR 100% 4.950 3.465 N PRIMA1 n/a
5 TRCN0000157402 GTTGCTGAGTATCCCATGAGT pLKO.1 1684 3UTR 100% 3.000 2.100 N PRIMA1 n/a
6 TRCN0000156629 GAGCAACAAAGGAGTAGACGT pLKO.1 1713 3UTR 100% 2.640 1.848 N PRIMA1 n/a
7 TRCN0000157170 GCAGAGCAACAAAGGAGTAGA pLKO.1 1710 3UTR 100% 4.950 2.970 N PRIMA1 n/a
8 TRCN0000157783 CTGGTGATCATCATTGCCGTA pLKO.1 385 3UTR 100% 2.160 1.296 N PRIMA1 n/a
9 TRCN0000154190 CAAAGGAGTAGACGTGAACAA pLKO.1 1719 3UTR 100% 4.950 6.930 N PRIMA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.