Transcript: Human XR_002957667.1

PREDICTED: Homo sapiens apoptosis and caspase activation inhibitor (AVEN), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AVEN (57099)
Length:
2184
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957667.1
NBCI Gene record:
AVEN (57099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143812 GACCTGAAATCCAAGGAAGAT pLKO.1 1082 3UTR 100% 4.950 3.465 N AVEN n/a
2 TRCN0000145470 GAGAAAGAATGGGATAGTGAA pLKO.1 632 3UTR 100% 4.950 3.465 N AVEN n/a
3 TRCN0000142013 GAGCAACCAAGTACCTCCAAA pLKO.1 1172 3UTR 100% 4.950 3.465 N AVEN n/a
4 TRCN0000122869 GTGGTCCAAGAGGAAGAAGTT pLKO.1 1109 3UTR 100% 4.950 3.465 N AVEN n/a
5 TRCN0000122854 GATGCAGAGACCTATGGAGAA pLKO.1 437 3UTR 100% 4.050 2.835 N AVEN n/a
6 TRCN0000145521 GAAGAACTAGATCTGTTGCTT pLKO.1 1004 3UTR 100% 3.000 2.100 N AVEN n/a
7 TRCN0000143218 GAGGGAGATAACATCTTACCA pLKO.1 1046 3UTR 100% 3.000 2.100 N AVEN n/a
8 TRCN0000143502 GTTGGACAGCATGATTTCCTA pLKO.1 1222 3UTR 100% 3.000 2.100 N AVEN n/a
9 TRCN0000142832 CAAGAGGAAGAAGTTTGTGCA pLKO.1 1115 3UTR 100% 2.640 1.848 N AVEN n/a
10 TRCN0000141963 GAACTGATGATGGCAAGGGAT pLKO.1 807 3UTR 100% 2.640 1.848 N AVEN n/a
11 TRCN0000144981 GAGAATGATGAACAGGGAAAT pLKO.1 458 3UTR 100% 10.800 6.480 N AVEN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.