Transcript: Human XR_002957984.1

PREDICTED: Homo sapiens CASC3 exon junction complex subunit (CASC3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASC3 (22794)
Length:
4176
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957984.1
NBCI Gene record:
CASC3 (22794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059920 CGGAAGAATCCAGCATACATA pLKO.1 569 3UTR 100% 5.625 7.875 N CASC3 n/a
2 TRCN0000300729 CGGAAGAATCCAGCATACATA pLKO_005 569 3UTR 100% 5.625 7.875 N CASC3 n/a
3 TRCN0000059919 CCTCAGTTTAACCGGATGGAA pLKO.1 1553 3UTR 100% 3.000 2.400 N CASC3 n/a
4 TRCN0000300668 CCTCAGTTTAACCGGATGGAA pLKO_005 1553 3UTR 100% 3.000 2.400 N CASC3 n/a
5 TRCN0000059921 CCCTACCACCAAGGACATTTA pLKO.1 912 3UTR 100% 13.200 9.240 N CASC3 n/a
6 TRCN0000300731 CCCTACCACCAAGGACATTTA pLKO_005 912 3UTR 100% 13.200 9.240 N CASC3 n/a
7 TRCN0000059922 GAAGCTAATGATGCTGTTAAT pLKO.1 395 3UTR 100% 13.200 9.240 N CASC3 n/a
8 TRCN0000300667 GAAGCTAATGATGCTGTTAAT pLKO_005 395 3UTR 100% 13.200 9.240 N CASC3 n/a
9 TRCN0000059918 CCCATTGAGAAGAAATCCTAT pLKO.1 1235 3UTR 100% 4.950 3.465 N CASC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.