Transcript: Human XR_002959840.1

PREDICTED: Homo sapiens transcription elongation regulator 1 (TCERG1), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCERG1 (10915)
Length:
7424
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959840.1
NBCI Gene record:
TCERG1 (10915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230336 GGTATGGAACCACGGTCATAA pLKO_005 7185 3UTR 100% 13.200 18.480 N TCERG1 n/a
2 TRCN0000014942 CCTCCTATCGTACCCATGATA pLKO.1 1176 3UTR 100% 5.625 7.875 N TCERG1 n/a
3 TRCN0000014938 CGGAGGAGATATGGGTTGAAA pLKO.1 418 3UTR 100% 5.625 4.500 N TCERG1 n/a
4 TRCN0000230334 TCCTAAAGAAGAGCCTATAAA pLKO_005 1436 3UTR 100% 15.000 10.500 N TCERG1 n/a
5 TRCN0000014941 CCACGTTACAAAGCAGTAGAT pLKO.1 5073 3UTR 100% 4.950 3.465 N TCERG1 n/a
6 TRCN0000014939 GCCAAGAATTTAGACTCAGAA pLKO.1 5142 3UTR 100% 4.950 3.465 N TCERG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.