Transcript: Mouse XR_003950181.1

PREDICTED: Mus musculus uncharacterized LOC115487965 (LOC115487965), ncRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
LOC115487965 (115487965)
Length:
28459
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003950181.1
NBCI Gene record:
LOC115487965 (115487965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003950181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176490 CCTGGGTTCTATAAGAAAGTA pLKO.1 10039 3UTR 100% 5.625 2.813 Y Il1bos n/a
2 TRCN0000166364 CACACACACACACACACACAA pLKO.1 25264 3UTR 100% 4.950 2.475 Y KAAG1 n/a
3 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 9883 3UTR 100% 4.950 2.475 Y Gad2 n/a
4 TRCN0000023010 CCTCATTTGCATGTTCCTCAT pLKO.1 3913 3UTR 100% 4.050 2.025 Y E030030I06Rik n/a
5 TRCN0000095809 CCCTGAATAAACTCTATTCTA pLKO.1 28073 3UTR 100% 0.563 0.281 Y Zfp560 n/a
6 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 25268 3UTR 100% 15.000 7.500 Y KAAG1 n/a
7 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 9824 3UTR 100% 4.050 2.025 Y Mtif2 n/a
8 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 13907 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003950181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.