Transcript: Mouse XR_003950854.1

PREDICTED: Mus musculus ecto-NOX disulfide-thiol exchanger 1 (Enox1), transcript variant X34, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Enox1 (239188)
Length:
3896
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003950854.1
NBCI Gene record:
Enox1 (239188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003950854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248604 GTTGACGGTCGCGTTGGTTAA pLKO_005 2768 3UTR 100% 10.800 15.120 N Enox1 n/a
2 TRCN0000191322 CAAGGAAATAATCCACTGCAA pLKO.1 1585 3UTR 100% 2.640 3.696 N Enox1 n/a
3 TRCN0000201942 CCACGGATGTTCAAACAGGAA pLKO.1 2985 3UTR 100% 2.640 3.696 N Enox1 n/a
4 TRCN0000248603 TGTGCCTTTGAAGGAATTAAA pLKO_005 3048 3UTR 100% 15.000 10.500 N Enox1 n/a
5 TRCN0000248605 CCAGACCTGTCCCTATGAATA pLKO_005 3280 3UTR 100% 13.200 9.240 N Enox1 n/a
6 TRCN0000248606 TCTGGTTACAGAATGCGATTA pLKO_005 1838 3UTR 100% 10.800 7.560 N Enox1 n/a
7 TRCN0000189981 GCAGGAAATGGAGGAAGCAAA pLKO.1 2227 3UTR 100% 4.950 3.465 N Enox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003950854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.