Transcript: Mouse XR_003954391.1

PREDICTED: Mus musculus leucine rich repeat and coiled-coil domain containing 1 (Lrrcc1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Lrrcc1 (71710)
Length:
5487
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003954391.1
NBCI Gene record:
Lrrcc1 (71710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003954391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113302 GCGAAGAGTAAACATGCTCTT pLKO.1 1945 3UTR 100% 0.405 0.567 N Lrrcc1 n/a
2 TRCN0000113304 GCCTTACCTTAGAGATTTATA pLKO.1 1288 3UTR 100% 15.000 10.500 N Lrrcc1 n/a
3 TRCN0000113303 GCACTTCCTAACCAATCTTAT pLKO.1 625 3UTR 100% 13.200 9.240 N Lrrcc1 n/a
4 TRCN0000113301 GCAGCCAATTTACAGAATCAA pLKO.1 2080 3UTR 100% 5.625 3.938 N Lrrcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003954391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.