Transcript: Mouse XR_003955006.1

PREDICTED: Mus musculus ubiquitin specific peptidase 40 (Usp40), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Usp40 (227334)
Length:
2818
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003955006.1
NBCI Gene record:
Usp40 (227334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003955006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030897 CCTCTGCTGTTAAACATTCTT pLKO.1 2082 3UTR 100% 5.625 3.938 N Usp40 n/a
2 TRCN0000030895 CCGACTGGTTAAAGCAGCAAA pLKO.1 836 3UTR 100% 4.950 3.465 N Usp40 n/a
3 TRCN0000030894 GCACAGATGAAAGTACAGTTA pLKO.1 1369 3UTR 100% 4.950 3.465 N Usp40 n/a
4 TRCN0000030898 GCCAATCAAATTCCTGTTGAT pLKO.1 1233 3UTR 100% 0.495 0.347 N Usp40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003955006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.