Transcript: Mouse XR_003955656.1

PREDICTED: Mus musculus CAP-GLY domain containing linker protein 2 (Clip2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Clip2 (269713)
Length:
4539
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003955656.1
NBCI Gene record:
Clip2 (269713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003955656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084700 CAAAGCTGAATGGCGGATAAA pLKO.1 4485 3UTR 100% 13.200 18.480 N Clip2 n/a
2 TRCN0000316016 CAAAGCTGAATGGCGGATAAA pLKO_005 4485 3UTR 100% 13.200 18.480 N Clip2 n/a
3 TRCN0000304416 TCCACAAGGTCATCCGAATTG pLKO_005 2637 3UTR 100% 10.800 8.640 N Clip2 n/a
4 TRCN0000304417 ACCTTGCTCCAGGACAAATAT pLKO_005 3368 3UTR 100% 15.000 10.500 N Clip2 n/a
5 TRCN0000084701 ACAAAGCTGAATGGCGGATAA pLKO.1 4484 3UTR 100% 10.800 7.560 N Clip2 n/a
6 TRCN0000084698 GCACAGCATGAGCAGTATGTT pLKO.1 2993 3UTR 100% 5.625 3.938 N Clip2 n/a
7 TRCN0000180874 GCACAGCATGAGCAGTATGTT pLKO.1 2993 3UTR 100% 5.625 3.938 N CLIP2 n/a
8 TRCN0000315942 GCACAGCATGAGCAGTATGTT pLKO_005 2993 3UTR 100% 5.625 3.938 N Clip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003955656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.