Transcript: Human XR_246276.3

PREDICTED: Homo sapiens tRNA methyltransferase 13 homolog (TRMT13), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRMT13 (54482)
Length:
7050
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_246276.3
NBCI Gene record:
TRMT13 (54482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_246276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365811 ACCTTTAGCCAAACGCATAAA pLKO_005 4509 3UTR 100% 13.200 18.480 N TRMT13 n/a
2 TRCN0000365813 CAACACATAATTAGCGTATTT pLKO_005 5672 3UTR 100% 13.200 18.480 N TRMT13 n/a
3 TRCN0000365751 AGGGTAGATGCGGTTACTATG pLKO_005 84 3UTR 100% 10.800 15.120 N TRMT13 n/a
4 TRCN0000062722 CCAAGGTCGAATCCAGTATTT pLKO.1 5236 3UTR 100% 13.200 9.240 N TRMT13 n/a
5 TRCN0000371090 GTCCTGCTTTGCAGTACTATA pLKO_005 5274 3UTR 100% 13.200 9.240 N TRMT13 n/a
6 TRCN0000371033 CACAGATGATGGCGCTGATTG pLKO_005 4851 3UTR 100% 10.800 7.560 N TRMT13 n/a
7 TRCN0000062718 CCTGAACAATTAGTTCCAATT pLKO.1 350 3UTR 100% 10.800 7.560 N TRMT13 n/a
8 TRCN0000365749 GATCTTGCATTACGATGTTTG pLKO_005 4447 3UTR 100% 10.800 7.560 N TRMT13 n/a
9 TRCN0000371034 TCAAGAGGTAGTGATTGATTG pLKO_005 5759 3UTR 100% 10.800 7.560 N TRMT13 n/a
10 TRCN0000062721 CCAAACGCATAAAGAATGATA pLKO.1 4517 3UTR 100% 5.625 3.938 N TRMT13 n/a
11 TRCN0000062719 GCATTGTTATTGCACTCTGTT pLKO.1 4616 3UTR 100% 4.950 3.465 N TRMT13 n/a
12 TRCN0000155565 CCATTGTGTTACAGTTGCCTA pLKO.1 1633 3UTR 100% 2.640 1.320 Y ORC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_246276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.