Transcript: Mouse XR_373183.3

PREDICTED: Mus musculus transcription factor AP-2 beta (Tfap2b), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfap2b (21419)
Length:
4695
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_373183.3
NBCI Gene record:
Tfap2b (21419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_373183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418525 ACTTCGGTTCTTTCGAATTTA pLKO_005 1897 3UTR 100% 15.000 21.000 N Tfap2b n/a
2 TRCN0000095425 GCCGTTTATCTCTACTCAGTT pLKO.1 971 3UTR 100% 4.950 6.930 N Tfap2b n/a
3 TRCN0000095428 CTGTTCACTTAGCTCGGGATT pLKO.1 1214 3UTR 100% 4.050 5.670 N Tfap2b n/a
4 TRCN0000095424 CCGGCTACATTTATCTGATAA pLKO.1 3333 3UTR 100% 13.200 10.560 N Tfap2b n/a
5 TRCN0000416400 CTAAAGCCGTGTCCGAGTATT pLKO_005 1265 3UTR 100% 13.200 9.240 N Tfap2b n/a
6 TRCN0000433281 TGGAGACAACCGTCCGGATTT pLKO_005 1873 3UTR 100% 10.800 7.560 N TFAP2B n/a
7 TRCN0000095426 CCTTGAGAGAAAGGCTAGAAA pLKO.1 1115 3UTR 100% 5.625 3.938 N Tfap2b n/a
8 TRCN0000095427 GTTCTTGAACAACACCACTAA pLKO.1 1560 3UTR 100% 4.950 3.465 N Tfap2b n/a
9 TRCN0000019662 CAGTCAGTTGAAGATGCCAAT pLKO.1 805 3UTR 100% 4.050 2.835 N TFAP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_373183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.