Transcript: Mouse XR_373259.3

PREDICTED: Mus musculus ring finger protein 149 (Rnf149), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf149 (67702)
Length:
2430
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_373259.3
NBCI Gene record:
Rnf149 (67702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_373259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190888 CCGATTCAATACTGTGACCTT pLKO.1 2233 3UTR 100% 2.640 3.696 N Rnf149 n/a
2 TRCN0000341960 CCGATTCAATACTGTGACCTT pLKO_005 2233 3UTR 100% 2.640 3.696 N Rnf149 n/a
3 TRCN0000200680 GCATGGCTGATATTCTATTAT pLKO.1 801 3UTR 100% 15.000 10.500 N Rnf149 n/a
4 TRCN0000352507 GCATGGCTGATATTCTATTAT pLKO_005 801 3UTR 100% 15.000 10.500 N Rnf149 n/a
5 TRCN0000201032 CCTTTCAGATTCAGGTTTGAT pLKO.1 1367 3UTR 100% 5.625 3.938 N Rnf149 n/a
6 TRCN0000201796 GAGAAGGGAATTGATGTCGAT pLKO.1 927 3UTR 100% 2.640 1.848 N Rnf149 n/a
7 TRCN0000341959 GAGAAGGGAATTGATGTCGAT pLKO_005 927 3UTR 100% 2.640 1.848 N Rnf149 n/a
8 TRCN0000202328 GCAACCTTCCATCATCTTCCT pLKO.1 1122 3UTR 100% 2.640 1.848 N Rnf149 n/a
9 TRCN0000342037 GCAACCTTCCATCATCTTCCT pLKO_005 1122 3UTR 100% 2.640 1.848 N Rnf149 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_373259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.