Transcript: Mouse XR_374113.1

PREDICTED: Mus musculus serologically defined colon cancer antigen 3 (Sdccag3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sdccag3 (68112)
Length:
2010
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374113.1
NBCI Gene record:
Sdccag3 (68112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249211 CACGACCACCAGCCGAATTTA pLKO_005 464 3UTR 100% 15.000 12.000 N Sdccag3 n/a
2 TRCN0000249208 TCGATAGACTCACTGATTTAC pLKO_005 1395 3UTR 100% 13.200 10.560 N Sdccag3 n/a
3 TRCN0000249209 CGGACGCTGCAGATAAGTTAT pLKO_005 873 3UTR 100% 13.200 9.240 N Sdccag3 n/a
4 TRCN0000249207 GCTGAAATCCTCAAGTCTATC pLKO_005 1151 3UTR 100% 10.800 7.560 N Sdccag3 n/a
5 TRCN0000190391 CCTTGAAGAAGCCAATCCATT pLKO.1 392 3UTR 100% 4.950 3.465 N Sdccag3 n/a
6 TRCN0000191991 GATAAGTTATGAAGCACTGAA pLKO.1 884 3UTR 100% 4.950 3.465 N Sdccag3 n/a
7 TRCN0000189560 CTCTCAAACTTGAGGCGAGAA pLKO.1 980 3UTR 100% 4.050 2.835 N Sdccag3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.