Transcript: Mouse XR_374417.2

PREDICTED: Mus musculus potassium voltage gated channel, Shab-related subfamily, member 1 (Kcnb1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnb1 (16500)
Length:
11014
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374417.2
NBCI Gene record:
Kcnb1 (16500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069403 CCCATTCCAATTATCGTCAAT pLKO.1 1555 3UTR 100% 4.950 6.930 N Kcnb1 n/a
2 TRCN0000069406 CGCCTTCACCTCTATTCTCAA pLKO.1 603 3UTR 100% 4.950 3.465 N Kcnb1 n/a
3 TRCN0000069405 GCCTTGGAGCTAGAACAGAAA pLKO.1 2690 3UTR 100% 4.950 3.465 N Kcnb1 n/a
4 TRCN0000069404 CCCAAGAAATGGAAGTTCTTT pLKO.1 1087 3UTR 100% 0.563 0.394 N Kcnb1 n/a
5 TRCN0000069407 CCAGAGAAACACACAGCAATA pLKO.1 2542 3UTR 100% 10.800 6.480 N Kcnb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.