Transcript: Mouse XR_374419.2

PREDICTED: Mus musculus kinesin family member 3B (Kif3b), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif3b (16569)
Length:
6000
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374419.2
NBCI Gene record:
Kif3b (16569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337925 CATTGGAAATTACATCCTATA pLKO_005 1991 3UTR 100% 10.800 15.120 N Kif3b n/a
2 TRCN0000091381 CGGGTAGGAAAGCTGAATCTT pLKO.1 869 3UTR 100% 5.625 4.500 N Kif3b n/a
3 TRCN0000091382 CGGTGCTACAAACATGAATGA pLKO.1 769 3UTR 100% 4.950 3.960 N Kif3b n/a
4 TRCN0000350886 TAAAGCTCAAGCATCTTATTA pLKO_005 1899 3UTR 100% 15.000 10.500 N Kif3b n/a
5 TRCN0000337922 AGGGTTTCAATGGCACAATTT pLKO_005 417 3UTR 100% 13.200 9.240 N Kif3b n/a
6 TRCN0000337923 GCAATCTTTGTTATCACTATT pLKO_005 809 3UTR 100% 13.200 9.240 N Kif3b n/a
7 TRCN0000337990 AGAATGCATGGGTAAGGTAAA pLKO_005 2977 3UTR 100% 10.800 7.560 N Kif3b n/a
8 TRCN0000091378 CCTCCCTTCTTGTTAAACAAT pLKO.1 3112 3UTR 100% 5.625 3.938 N Kif3b n/a
9 TRCN0000091380 CCATTGGAAATTACATCCTAT pLKO.1 1990 3UTR 100% 4.950 3.465 N Kif3b n/a
10 TRCN0000091379 GCAGGGTTTCAATGGCACAAT pLKO.1 415 3UTR 100% 4.950 3.465 N Kif3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.