Transcript: Mouse XR_374500.2

PREDICTED: Mus musculus lipin 3 (Lpin3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lpin3 (64899)
Length:
2668
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374500.2
NBCI Gene record:
Lpin3 (64899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097632 CGGTGTCTAAACCTGAACGAA pLKO.1 2181 3UTR 100% 3.000 4.200 N Lpin3 n/a
2 TRCN0000097631 CCCAGAGAGTAAGGAAACCAA pLKO.1 1300 3UTR 100% 3.000 2.100 N Lpin3 n/a
3 TRCN0000097633 CCTAAGAGTGACTCAGAGCTA pLKO.1 983 3UTR 100% 2.640 1.848 N Lpin3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.