Transcript: Mouse XR_375453.3

PREDICTED: Mus musculus major facilitator superfamily domain containing 8 (Mfsd8), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mfsd8 (72175)
Length:
3009
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375453.3
NBCI Gene record:
Mfsd8 (72175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375453.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101129 ACGTCAGTGTAAGAGTGTGAA pLKO.1 877 3UTR 100% 4.950 6.930 N Mfsd8 n/a
2 TRCN0000101125 CCTGGGAGATTAGACTAACAT pLKO.1 2611 3UTR 100% 5.625 4.500 N Mfsd8 n/a
3 TRCN0000101128 CCCAAGAGCATTACAAGAGTA pLKO.1 237 3UTR 100% 4.950 3.960 N Mfsd8 n/a
4 TRCN0000101126 CGTCAGTGTAAGAGTGTGAAT pLKO.1 878 3UTR 100% 4.950 3.465 N Mfsd8 n/a
5 TRCN0000101127 GCTGGGTTATTGCTTCATATA pLKO.1 384 3UTR 100% 13.200 6.600 Y Mfsd8 n/a
6 TRCN0000152401 GCTGGGTTATTGCTTCATATA pLKO.1 384 3UTR 100% 13.200 6.600 Y MFSD8 n/a
7 TRCN0000353713 GCTGGGTTATTGCTTCATATA pLKO_005 384 3UTR 100% 13.200 6.600 Y MFSD8 n/a
8 TRCN0000151791 CTTCATATAGTCTTGGCCAAA pLKO.1 396 3UTR 100% 4.050 2.025 Y MFSD8 n/a
9 TRCN0000154715 GCCAAATGGTAGCTTCACCTA pLKO.1 411 3UTR 100% 2.640 1.320 Y MFSD8 n/a
10 TRCN0000331075 GCCAAATGGTAGCTTCACCTA pLKO_005 411 3UTR 100% 2.640 1.320 Y MFSD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375453.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.