Transcript: Mouse XR_375566.3

PREDICTED: Mus musculus acid phosphatase 6, lysophosphatidic (Acp6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acp6 (66659)
Length:
1643
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375566.3
NBCI Gene record:
Acp6 (66659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071416 CCACCTCAAACTCGGTTTGAT pLKO.1 645 3UTR 100% 0.563 0.788 N Acp6 n/a
2 TRCN0000313149 TACCAGCACCAAGAATCTAAG pLKO_005 1381 3UTR 100% 0.000 0.000 N Acp6 n/a
3 TRCN0000313151 TTCGCTCCACCAACATGTTTC pLKO_005 877 3UTR 100% 10.800 8.640 N Acp6 n/a
4 TRCN0000313219 TTTAGAGATCCCACCTCAAAC pLKO_005 635 3UTR 100% 10.800 8.640 N Acp6 n/a
5 TRCN0000313150 CCAGAAAGATGTACCTCTATG pLKO_005 1265 3UTR 100% 10.800 7.560 N Acp6 n/a
6 TRCN0000071413 GCCCGAAACCTCATTCTCATT pLKO.1 691 3UTR 100% 4.950 3.465 N Acp6 n/a
7 TRCN0000312174 GCCCGAAACCTCATTCTCATT pLKO_005 691 3UTR 100% 4.950 3.465 N Acp6 n/a
8 TRCN0000071417 CCAAGAATCTAAGGAGTGGTT pLKO.1 1389 3UTR 100% 2.640 1.584 N Acp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.