Transcript: Mouse XR_375571.3

PREDICTED: Mus musculus RAB13, member RAS oncogene family (Rab13), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab13 (68328)
Length:
1298
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375571.3
NBCI Gene record:
Rab13 (68328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381911 AGATCCGAACCGTGGACATAG pLKO_005 409 3UTR 100% 10.800 15.120 N Rab13 n/a
2 TRCN0000100858 CGAGAGCACAGAATCCGATTT pLKO.1 722 3UTR 100% 10.800 8.640 N Rab13 n/a
3 TRCN0000302788 CGAGAGCACAGAATCCGATTT pLKO_005 722 3UTR 100% 10.800 8.640 N Rab13 n/a
4 TRCN0000100856 GCCAAGAACGATTCAAGACAA pLKO.1 469 3UTR 100% 4.950 3.960 N Rab13 n/a
5 TRCN0000302714 GCCAAGAACGATTCAAGACAA pLKO_005 469 3UTR 100% 4.950 3.960 N Rab13 n/a
6 TRCN0000048122 CGAGAATATTCAGAACTGGAT pLKO.1 560 3UTR 100% 2.640 2.112 N RAB13 n/a
7 TRCN0000381648 AGATCGGGAACCAACAGTAAG pLKO_005 830 3UTR 100% 10.800 7.560 N Rab13 n/a
8 TRCN0000100855 GAGCATTTCTTGCCTCCTATT pLKO.1 911 3UTR 100% 10.800 7.560 N Rab13 n/a
9 TRCN0000302787 GAGCATTTCTTGCCTCCTATT pLKO_005 911 3UTR 100% 10.800 7.560 N Rab13 n/a
10 TRCN0000100857 CCAAGAACGATTCAAGACAAT pLKO.1 470 3UTR 100% 4.950 3.465 N Rab13 n/a
11 TRCN0000100859 GATGAGAAATCCTTCGAGAAT pLKO.1 546 3UTR 100% 4.950 3.465 N Rab13 n/a
12 TRCN0000302789 GATGAGAAATCCTTCGAGAAT pLKO_005 546 3UTR 100% 4.950 3.465 N Rab13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.