Transcript: Mouse XR_376818.3

PREDICTED: Mus musculus hepatocyte growth factor activator (Hgfac), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hgfac (54426)
Length:
1663
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_376818.3
NBCI Gene record:
Hgfac (54426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_376818.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031893 GTGCGCTACAACACACAACTA pLKO.1 470 3UTR 100% 4.950 3.960 N Hgfac n/a
2 TRCN0000323725 GTGCGCTACAACACACAACTA pLKO_005 470 3UTR 100% 4.950 3.960 N Hgfac n/a
3 TRCN0000375764 ATGAAACACGCTATGAGTATT pLKO_005 685 3UTR 100% 13.200 9.240 N Hgfac n/a
4 TRCN0000031889 CCTGGGAAATGGTACAGAGTA pLKO.1 935 3UTR 100% 4.950 3.465 N Hgfac n/a
5 TRCN0000031892 GCTGCCATCTACATTGGGAAT pLKO.1 1344 3UTR 100% 4.050 2.835 N Hgfac n/a
6 TRCN0000323723 GCTGCCATCTACATTGGGAAT pLKO_005 1344 3UTR 100% 4.050 2.835 N Hgfac n/a
7 TRCN0000031890 GCACAAGAAGAGGACGTTCTT pLKO.1 1268 3UTR 100% 0.495 0.347 N Hgfac n/a
8 TRCN0000323785 GCACAAGAAGAGGACGTTCTT pLKO_005 1268 3UTR 100% 0.495 0.347 N Hgfac n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_376818.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.