Transcript: Mouse XR_377470.3

PREDICTED: Mus musculus family with sequence similarity 188, member B (Fam188b), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mindy4 (330323)
Length:
4373
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377470.3
NBCI Gene record:
Mindy4 (330323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283137 ACTCATCAGAGCCCGGTATAG pLKO_005 716 3UTR 100% 10.800 8.640 N Mindy4 n/a
2 TRCN0000192124 CAATGACATTGCCTCGTTAAA pLKO.1 1434 3UTR 100% 13.200 9.240 N Mindy4 n/a
3 TRCN0000264714 GTCTGACAGGACGGATGATAA pLKO_005 1212 3UTR 100% 13.200 9.240 N Mindy4 n/a
4 TRCN0000264715 AGCTCATTACCAGGTACTTTC pLKO_005 374 3UTR 100% 10.800 7.560 N Mindy4 n/a
5 TRCN0000283136 TCAATGACATTGCCTCGTTAA pLKO_005 1433 3UTR 100% 10.800 7.560 N Mindy4 n/a
6 TRCN0000191599 GAGTTGATAAAGGAAGACATT pLKO.1 1267 3UTR 100% 4.950 3.465 N Mindy4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.