Transcript: Mouse XR_377489.1

PREDICTED: Mus musculus TAM41 mitochondrial translocator assembly and maintenance homolog (Tamm41), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tamm41 (68971)
Length:
1190
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377489.1
NBCI Gene record:
Tamm41 (68971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183339 GAGAATCCCATGTTAGACTTA pLKO.1 254 3UTR 100% 4.950 3.960 N Tamm41 n/a
2 TRCN0000293089 GAGAATCCCATGTTAGACTTA pLKO_005 254 3UTR 100% 4.950 3.960 N Tamm41 n/a
3 TRCN0000183025 CTCCTCCATCCAGAATAATTA pLKO.1 373 3UTR 100% 15.000 10.500 N Tamm41 n/a
4 TRCN0000293147 CTCCTCCATCCAGAATAATTA pLKO_005 373 3UTR 100% 15.000 10.500 N Tamm41 n/a
5 TRCN0000217616 GAATGAGAACATGGCTCTTAG pLKO.1 550 3UTR 100% 10.800 7.560 N Tamm41 n/a
6 TRCN0000196063 GCGACTAGCGATCTCATCAAT pLKO.1 984 3UTR 100% 5.625 3.938 N Tamm41 n/a
7 TRCN0000183879 CCTCATGCTACCTGAAAGCTT pLKO.1 616 3UTR 100% 3.000 2.100 N Tamm41 n/a
8 TRCN0000293091 CCTCATGCTACCTGAAAGCTT pLKO_005 616 3UTR 100% 3.000 2.100 N Tamm41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.