Transcript: Mouse XR_378912.3

PREDICTED: Mus musculus RIKEN cDNA 1700029J07 gene (1700029J07Rik), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1700029J07Rik (69479)
Length:
1937
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378912.3
NBCI Gene record:
1700029J07Rik (69479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378912.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192668 GAAAGTATAATGGCGCTGAAT pLKO.1 1311 3UTR 100% 4.950 6.930 N 1700029J07Rik n/a
2 TRCN0000192500 GATATGGCTATGCCAATGTTA pLKO.1 907 3UTR 100% 5.625 4.500 N 1700029J07Rik n/a
3 TRCN0000201075 CAAGTGGATTAGGAAGCTATT pLKO.1 775 3UTR 100% 10.800 7.560 N 1700029J07Rik n/a
4 TRCN0000217751 CCTCTTCAGTGAGATGGAATA pLKO.1 497 3UTR 100% 10.800 7.560 N 1700029J07Rik n/a
5 TRCN0000201725 GCAAAGCTTTCATCCCTAGTA pLKO.1 739 3UTR 100% 4.950 3.465 N 1700029J07Rik n/a
6 TRCN0000189638 CCTTCGAAAGGTGAAAGGGTT pLKO.1 1254 3UTR 100% 2.640 1.848 N 1700029J07Rik n/a
7 TRCN0000201813 GCGACAAATATGTGTCACCAT pLKO.1 529 3UTR 100% 2.640 1.848 N 1700029J07Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378912.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.