Transcript: Mouse XR_379397.1

PREDICTED: Mus musculus hexosaminidase A (Hexa), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hexa (15211)
Length:
1918
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379397.1
NBCI Gene record:
Hexa (15211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111267 CCTGACAACTAATATAGACTT pLKO.1 1567 3UTR 100% 4.950 6.930 N Hexa n/a
2 TRCN0000334533 CCTGACAACTAATATAGACTT pLKO_005 1567 3UTR 100% 4.950 6.930 N Hexa n/a
3 TRCN0000111266 GCTGGATACATCTCGCCATTA pLKO.1 698 3UTR 100% 10.800 7.560 N Hexa n/a
4 TRCN0000351153 GCTGGATACATCTCGCCATTA pLKO_005 698 3UTR 100% 10.800 7.560 N Hexa n/a
5 TRCN0000111268 CCATTAATGATGACCAGTGTT pLKO.1 535 3UTR 100% 4.950 3.465 N Hexa n/a
6 TRCN0000334508 CCATTAATGATGACCAGTGTT pLKO_005 535 3UTR 100% 4.950 3.465 N Hexa n/a
7 TRCN0000111265 CCCAGGAGGTTGCTGTCCTTT pLKO.1 1711 3UTR 100% 1.650 0.990 N Hexa n/a
8 TRCN0000334518 CCCAGGAGGTTGCTGTCCTTT pLKO_005 1711 3UTR 100% 1.650 0.990 N Hexa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.