Transcript: Mouse XR_379847.2

PREDICTED: Mus musculus collagen, type VII, alpha 1 (Col7a1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col7a1 (12836)
Length:
8541
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379847.2
NBCI Gene record:
Col7a1 (12836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080137 CCACTGAATAGTTCCCATGAT pLKO.1 3385 3UTR 100% 4.950 6.930 N Col7a1 n/a
2 TRCN0000080136 GCTCAGCTATAAAGGTGGTAA pLKO.1 393 3UTR 100% 4.950 6.930 N Col7a1 n/a
3 TRCN0000080135 CCGCATCTTCTGTTGAGCAAA pLKO.1 1304 3UTR 100% 4.950 3.465 N Col7a1 n/a
4 TRCN0000080134 GCCAGTTTATTGCGTCTGGAT pLKO.1 8502 3UTR 100% 2.640 1.848 N Col7a1 n/a
5 TRCN0000320581 GAGCCAGTGGATTTCGGATTA pLKO_005 1934 3UTR 100% 10.800 15.120 N COL7A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.