Transcript: Mouse XR_380377.2

PREDICTED: Mus musculus phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma (Pip5k1c), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pip5k1c (18717)
Length:
5738
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380377.2
NBCI Gene record:
Pip5k1c (18717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380377.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285712 TCGGGAGAGACTACGTATAAG pLKO_005 295 3UTR 100% 13.200 18.480 N Pip5k1c n/a
2 TRCN0000024529 GCACCTTAAGTTCGACCTCAA pLKO.1 843 3UTR 100% 4.050 5.670 N Pip5k1c n/a
3 TRCN0000274622 TGGCCCAGAAGGCTCTGTATT pLKO_005 1142 3UTR 100% 13.200 9.240 N Pip5k1c n/a
4 TRCN0000024531 CCGTCCAGATGACTATTTGTA pLKO.1 549 3UTR 100% 5.625 3.938 N Pip5k1c n/a
5 TRCN0000274623 CCGTCCAGATGACTATTTGTA pLKO_005 549 3UTR 100% 5.625 3.938 N Pip5k1c n/a
6 TRCN0000024530 GCACCCTCTACAGACATCTAT pLKO.1 1981 3UTR 100% 5.625 3.938 N Pip5k1c n/a
7 TRCN0000024533 CGGGATCATTGATATTCTGCA pLKO.1 1281 3UTR 100% 2.640 1.848 N Pip5k1c n/a
8 TRCN0000274624 CGGGATCATTGATATTCTGCA pLKO_005 1281 3UTR 100% 2.640 1.848 N Pip5k1c n/a
9 TRCN0000037664 GCAGTCCTACAGGTTCATCAA pLKO.1 1299 3UTR 100% 4.950 2.970 N PIP5K1C n/a
10 TRCN0000378595 CGGCGAGAGCGACACATAATT pLKO_005 3514 3UTR 100% 15.000 10.500 N PIP5K1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380377.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.