Transcript: Mouse XR_380402.2

PREDICTED: Mus musculus ATP-binding cassette, sub-family A (ABC1), member 7 (Abca7), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abca7 (27403)
Length:
5538
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380402.2
NBCI Gene record:
Abca7 (27403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336028 CAGAACCTCACTGGCCGAAAT pLKO_005 4343 3UTR 100% 10.800 15.120 N Abca7 n/a
2 TRCN0000113393 CCTACGATTCAAGATTCGAAT pLKO.1 1513 3UTR 100% 4.950 6.930 N Abca7 n/a
3 TRCN0000353358 AGCGCTGCGTTGCTGGTATTA pLKO_005 1946 3UTR 100% 13.200 10.560 N Abca7 n/a
4 TRCN0000335966 CTGACTCTGGCCTGGATTTAT pLKO_005 1790 3UTR 100% 15.000 10.500 N Abca7 n/a
5 TRCN0000336029 TACGAAGCCAACCAGCTTAAT pLKO_005 851 3UTR 100% 13.200 9.240 N Abca7 n/a
6 TRCN0000336027 AGAAGTTGGAGGCTATCAAAG pLKO_005 1233 3UTR 100% 10.800 7.560 N Abca7 n/a
7 TRCN0000113390 CCGCAGTACAATGTGCTGTTT pLKO.1 2789 3UTR 100% 4.950 3.465 N Abca7 n/a
8 TRCN0000113394 GCCAACAATGGACTCCTACAT pLKO.1 4673 3UTR 100% 4.950 3.465 N Abca7 n/a
9 TRCN0000113392 GCTAGGGAACATCCTTCCTTA pLKO.1 1975 3UTR 100% 4.950 3.465 N Abca7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.