Transcript: Mouse XR_380404.3

PREDICTED: Mus musculus transmembrane and tetratricopeptide repeat containing 2 (Tmtc2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tmtc2 (278279)
Length:
5820
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380404.3
NBCI Gene record:
Tmtc2 (278279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249556 TATGCTACTGCCACGTTAATT pLKO_005 2093 3UTR 100% 15.000 21.000 N Tmtc2 n/a
2 TRCN0000249555 CTGGCAGTTTCAGCCGTTTAT pLKO_005 1301 3UTR 100% 13.200 18.480 N Tmtc2 n/a
3 TRCN0000257918 TAATCGCAGAGCGAGTCTTAT pLKO_005 1977 3UTR 100% 13.200 18.480 N Tmtc2 n/a
4 TRCN0000216959 CTCACCTCCTATTAGCTATTT pLKO.1 4603 3UTR 100% 13.200 10.560 N Tmtc2 n/a
5 TRCN0000249554 TAGCTATTTCAGTGATCATTT pLKO_005 4615 3UTR 100% 13.200 10.560 N Tmtc2 n/a
6 TRCN0000173924 GCCCTGAGTGTATATAGGGAA pLKO.1 2597 3UTR 100% 2.640 2.112 N Tmtc2 n/a
7 TRCN0000176179 GCTGACATGCTGTATAATCTA pLKO.1 2303 3UTR 100% 5.625 3.938 N Tmtc2 n/a
8 TRCN0000175964 GCTACATTAAGCACTGTTCTA pLKO.1 1185 3UTR 100% 4.950 3.465 N Tmtc2 n/a
9 TRCN0000257915 AGCAAGACTGAGACCTAATTA pLKO_005 3037 3UTR 100% 15.000 10.500 N Tmtc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.