Transcript: Mouse XR_381472.3

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class H (Pigh), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pigh (110417)
Length:
1268
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_381472.3
NBCI Gene record:
Pigh (110417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_381472.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098793 CATTATCATTAACGAGGCTAT pLKO.1 481 3UTR 100% 4.050 5.670 N Pigh n/a
2 TRCN0000098792 CCTGCTTGGTTACCTCCATTT pLKO.1 343 3UTR 100% 10.800 7.560 N Pigh n/a
3 TRCN0000098794 CCAGGAGACTCTACTAATCAT pLKO.1 376 3UTR 100% 5.625 3.938 N Pigh n/a
4 TRCN0000098791 CTACTAATCATCGACTCACTT pLKO.1 386 3UTR 100% 4.950 3.465 N Pigh n/a
5 TRCN0000098790 GTCATTTACTACCTCTGCATT pLKO.1 603 3UTR 100% 4.950 2.475 Y Pigh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_381472.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.