Transcript: Mouse XR_383169.3

PREDICTED: Mus musculus spindle and kinetochore associated complex subunit 3 (Ska3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ska3 (219114)
Length:
2286
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383169.3
NBCI Gene record:
Ska3 (219114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190173 CCTCCGAAAGTTACTGCGATT pLKO.1 1171 3UTR 100% 4.050 5.670 N Ska3 n/a
2 TRCN0000200774 GATTACACAATGGGACTTAAA pLKO.1 863 3UTR 100% 13.200 9.240 N Ska3 n/a
3 TRCN0000201258 GCTTCTCCCTTGGATGTTAAA pLKO.1 1237 3UTR 100% 13.200 9.240 N Ska3 n/a
4 TRCN0000189892 CCCGATTCTACCTGGAAGATT pLKO.1 1541 3UTR 100% 5.625 3.938 N Ska3 n/a
5 TRCN0000202093 CCCAGAGTTAGCTGTGTGTAA pLKO.1 523 3UTR 100% 4.950 3.465 N Ska3 n/a
6 TRCN0000192241 CTCTTCTCGATGAAGCAAGAT pLKO.1 342 3UTR 100% 4.950 3.465 N Ska3 n/a
7 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2055 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.