Transcript: Mouse XR_383183.3

PREDICTED: Mus musculus leucine rich repeat containing 16B (Lrrc16b), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Carmil3 (268747)
Length:
2938
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383183.3
NBCI Gene record:
Carmil3 (268747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099553 CGCACCAGCATCCTTATCAAT pLKO.1 2102 3UTR 100% 5.625 7.875 N Carmil3 n/a
2 TRCN0000168801 GAACTTCAATGTCAAGGCCAA pLKO.1 1984 3UTR 100% 2.160 3.024 N CARMIL3 n/a
3 TRCN0000099552 GCCAGCCTTCAAGCAATTCTT pLKO.1 1669 3UTR 100% 5.625 3.938 N Carmil3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.