Transcript: Mouse XR_383187.4

PREDICTED: Mus musculus excision repair cross-complementing rodent repair deficiency, complementation group 6 (Ercc6), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ercc6 (319955)
Length:
8791
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383187.4
NBCI Gene record:
Ercc6 (319955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173450 CGAGCAAGAAACCACATGATT pLKO.1 4598 3UTR 100% 5.625 4.500 N Ercc6 n/a
2 TRCN0000194536 GAGCAGCGATGATTATGTGTT pLKO.1 4031 3UTR 100% 4.950 3.465 N Ercc6 n/a
3 TRCN0000173630 GCATCCTTCATCACTAACAGA pLKO.1 4456 3UTR 100% 3.000 2.100 N Ercc6 n/a
4 TRCN0000173411 GAGGAACTTCATTGCTTTCCA pLKO.1 4714 3UTR 100% 3.000 1.800 N Ercc6 n/a
5 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 5923 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.