Transcript: Mouse XR_383834.3

PREDICTED: Mus musculus ubiquitin protein ligase E3 component n-recognin 5 (Ubr5), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubr5 (70790)
Length:
6306
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383834.3
NBCI Gene record:
Ubr5 (70790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238585 GCCCTTATATACTGGATTAAA pLKO_005 6187 3UTR 100% 15.000 12.000 N Ubr5 n/a
2 TRCN0000238583 ACTGGAGCAGGCTACTATTAA pLKO_005 550 3UTR 100% 15.000 10.500 N Ubr5 n/a
3 TRCN0000238586 TCAAGTGTACAGCAGATATTT pLKO_005 4590 3UTR 100% 15.000 10.500 N Ubr5 n/a
4 TRCN0000003411 GCTCGTCTTGATCTACTTTAT pLKO.1 4172 3UTR 100% 13.200 9.240 N UBR5 n/a
5 TRCN0000003410 GCCTTACAGAAATGCCCAGAA pLKO.1 1621 3UTR 100% 4.050 2.430 N UBR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.