Transcript: Mouse XR_384541.2

PREDICTED: Mus musculus transmembrane serine protease 7 (Tmprss7), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmprss7 (208171)
Length:
6681
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384541.2
NBCI Gene record:
Tmprss7 (208171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032175 CCAAGTTACTATCCTCCGAAA pLKO.1 6016 3UTR 100% 4.050 5.670 N Tmprss7 n/a
2 TRCN0000032178 CTTGGTAGAATATGGCGGTTA pLKO.1 6270 3UTR 100% 4.050 5.670 N Tmprss7 n/a
3 TRCN0000032177 CTCCATTGAATCCATCCAATT pLKO.1 5718 3UTR 100% 10.800 7.560 N Tmprss7 n/a
4 TRCN0000032174 GCCCTGAAATTCTACAACTAT pLKO.1 6085 3UTR 100% 5.625 3.938 N Tmprss7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.