Transcript: Mouse XR_385254.3

PREDICTED: Mus musculus serine/threonine kinase 38 (Stk38), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk38 (106504)
Length:
1864
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385254.3
NBCI Gene record:
Stk38 (106504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197233 GCAACCTTATCGCTCAACATG pLKO.1 397 3UTR 100% 4.950 6.930 N STK38 n/a
2 TRCN0000195165 CAACATGAAGAACGAGAAATG pLKO.1 411 3UTR 100% 10.800 7.560 N STK38 n/a
3 TRCN0000285614 CAACATGAAGAACGAGAAATG pLKO_005 411 3UTR 100% 10.800 7.560 N Stk38 n/a
4 TRCN0000276705 CTCATCCATGAGTAATCATAC pLKO_005 329 3UTR 100% 10.800 7.560 N Stk38 n/a
5 TRCN0000022867 CGGAAGGAAACAGAGTTTCTT pLKO.1 513 3UTR 100% 5.625 3.938 N Stk38 n/a
6 TRCN0000022865 GCTAAACCTCTACCTAATCAT pLKO.1 779 3UTR 100% 5.625 3.938 N Stk38 n/a
7 TRCN0000276706 GCTAAACCTCTACCTAATCAT pLKO_005 779 3UTR 100% 5.625 3.938 N Stk38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.