Transcript: Mouse XR_385292.2

PREDICTED: Mus musculus histocompatibility 2, Q region locus 7 (H2-Q7), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H2-Q7 (15018)
Length:
1428
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385292.2
NBCI Gene record:
H2-Q7 (15018)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385292.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066948 CAGAGCCCTCAGTTCTCTTTA pLKO.1 1073 3UTR 100% 13.200 6.600 Y H2-Q7 n/a
2 TRCN0000425243 GTGATGAATAGGAGGTGAAAC pLKO_005 777 3UTR 100% 10.800 5.400 Y H2-Q7 n/a
3 TRCN0000430534 TTGGAGCTGTGGCCATCATTG pLKO_005 739 3UTR 100% 10.800 5.400 Y H2-Q7 n/a
4 TRCN0000437894 AGCCAAACACTGGGTACATCT pLKO_005 1226 3UTR 100% 4.950 2.475 Y H2-Q7 n/a
5 TRCN0000066663 CCCTCAGTTCTCTTTAGACAA pLKO.1 1078 3UTR 100% 4.950 2.475 Y H2-Q10 n/a
6 TRCN0000066566 GCCCTGAACGAAGACCTGAAA pLKO.1 510 3UTR 100% 4.950 2.475 Y H2-Q8 n/a
7 TRCN0000066949 GTCTCCAACATGGCGACCATT pLKO.1 702 3UTR 100% 4.950 2.475 Y H2-Q7 n/a
8 TRCN0000066567 GTGGATGTATGGCTGTGACAT pLKO.1 425 3UTR 100% 4.950 2.475 Y H2-Q8 n/a
9 TRCN0000066951 GCGACCATTGCTGTTGTGGTT pLKO.1 714 3UTR 100% 2.640 1.320 Y H2-Q7 n/a
10 TRCN0000066952 GCAATATTTCCACACCGCTGT pLKO.1 152 3UTR 100% 2.160 1.080 Y H2-Q7 n/a
11 TRCN0000066563 CCGCGATTACATCGCCCTGAA pLKO.1 497 3UTR 100% 1.350 0.675 Y H2-Q8 n/a
12 TRCN0000066950 CGGGCCAACACTCGCTGCAAT pLKO.1 136 3UTR 100% 0.000 0.000 Y H2-Q7 n/a
13 TRCN0000066666 CCAGTGGATGTATGGCTGTAA pLKO.1 422 3UTR 100% 4.950 2.475 Y H2-Q10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385292.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.