Transcript: Mouse XR_385304.2

PREDICTED: Mus musculus ral guanine nucleotide dissociation stimulator-like 2 (Rgl2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgl2 (19732)
Length:
2697
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385304.2
NBCI Gene record:
Rgl2 (19732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110137 CCTCCGACCTAACTCTGATAT pLKO.1 2021 3UTR 100% 13.200 18.480 N Rgl2 n/a
2 TRCN0000110136 GTGTTATTAGTCGTGTCCTTA pLKO.1 2614 3UTR 100% 4.950 6.930 N Rgl2 n/a
3 TRCN0000110139 GATGCGGAACTGTTTCTTAAT pLKO.1 1322 3UTR 100% 13.200 9.240 N Rgl2 n/a
4 TRCN0000455106 GGAGAATGGCTACATCAATTT pLKO_005 1909 3UTR 100% 13.200 9.240 N Rgl2 n/a
5 TRCN0000110138 CCTAACTCTGATATCCAGCAA pLKO.1 2028 3UTR 100% 2.640 1.848 N Rgl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.