Transcript: Mouse XR_385351.3

PREDICTED: Mus musculus zinc finger protein 318 (Zfp318), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp318 (57908)
Length:
3974
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385351.3
NBCI Gene record:
Zfp318 (57908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240937 ATACCAGTACTAGGCTCAATT pLKO_005 2952 3UTR 100% 13.200 18.480 N Zfp318 n/a
2 TRCN0000216624 GTTGCTGCTTATGAGTATTAT pLKO.1 3564 3UTR 100% 15.000 12.000 N Zfp318 n/a
3 TRCN0000193076 CGGAATAGAGACAAACTTAAA pLKO.1 1185 3UTR 100% 13.200 10.560 N Zfp318 n/a
4 TRCN0000158790 GCTGCTTATGAGTATTATGAT pLKO.1 3567 3UTR 100% 5.625 4.500 N ZNF318 n/a
5 TRCN0000240936 GCTCGGATACCTCCAAATTAT pLKO_005 2718 3UTR 100% 15.000 10.500 N Zfp318 n/a
6 TRCN0000240938 TCGACTTCAGGATAGTATTAT pLKO_005 3242 3UTR 100% 15.000 10.500 N Zfp318 n/a
7 TRCN0000240940 AGACCATAGGGCTGGATATTG pLKO_005 2212 3UTR 100% 13.200 9.240 N Zfp318 n/a
8 TRCN0000159089 GCTGTAAAGCTAGAATCACTA pLKO.1 2148 3UTR 100% 4.950 3.465 N ZNF318 n/a
9 TRCN0000216730 GGGATGAAGAAGAGGATATAA pLKO.1 2044 3UTR 100% 15.000 9.000 N Zfp318 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.