Transcript: Mouse XR_385982.3

PREDICTED: Mus musculus treacle ribosome biogenesis factor 1 (Tcof1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcof1 (21453)
Length:
3854
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385982.3
NBCI Gene record:
Tcof1 (21453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385982.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295373 CAAGACCGACACCTGTCAATT pLKO_005 439 3UTR 100% 13.200 18.480 N Tcof1 n/a
2 TRCN0000295431 CGGCTTGACTGTGGCTAATTC pLKO_005 3402 3UTR 100% 13.200 18.480 N Tcof1 n/a
3 TRCN0000295374 AGCAGCTCTCAGGGTCCAAAT pLKO_005 1538 3UTR 100% 10.800 7.560 N Tcof1 n/a
4 TRCN0000110801 CCTACAGAATCCAGCGAAGAT pLKO.1 3334 3UTR 100% 4.950 3.465 N Tcof1 n/a
5 TRCN0000110802 CCTCATTTACCATCATCTGTT pLKO.1 161 3UTR 100% 4.950 3.465 N Tcof1 n/a
6 TRCN0000110800 CGAGGTGAAATCTCCAGCAAA pLKO.1 755 3UTR 100% 4.950 3.465 N Tcof1 n/a
7 TRCN0000288097 CGAGGTGAAATCTCCAGCAAA pLKO_005 755 3UTR 100% 4.950 3.465 N Tcof1 n/a
8 TRCN0000110804 CCCTCATTTACCATCATCTGT pLKO.1 160 3UTR 100% 3.000 2.100 N Tcof1 n/a
9 TRCN0000110803 GCCACCAACAAGCTCGGGAAA pLKO.1 3133 3UTR 100% 1.350 0.810 N Tcof1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385982.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.