Transcript: Mouse XR_386464.3

PREDICTED: Mus musculus RAB6A GEF complex partner 1 (Ric1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ric1 (226089)
Length:
5706
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386464.3
NBCI Gene record:
Ric1 (226089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386464.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264563 TGCCGTTTCATATCAACATTT pLKO_005 2542 3UTR 100% 13.200 18.480 N Ric1 n/a
2 TRCN0000264561 TGCCGACACATGATTCGATTT pLKO_005 3156 3UTR 100% 10.800 15.120 N Ric1 n/a
3 TRCN0000264560 CCTAGAAGAGGTGCGCTTAAA pLKO_005 3443 3UTR 100% 13.200 9.240 N Ric1 n/a
4 TRCN0000264564 TCCATGGAGTTGGCGAGTAAA pLKO_005 3978 3UTR 100% 13.200 9.240 N Ric1 n/a
5 TRCN0000183800 CGACACATGATTCGATTTCTT pLKO.1 3159 3UTR 100% 5.625 3.938 N RIC1 n/a
6 TRCN0000183186 GCCTCTTACCTTATTATCTTA pLKO.1 3051 3UTR 100% 5.625 3.938 N RIC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386464.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.