Transcript: Mouse XR_387153.3

PREDICTED: Mus musculus sushi, nidogen and EGF-like domains 1 (Sned1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sned1 (208777)
Length:
2680
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387153.3
NBCI Gene record:
Sned1 (208777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099763 GCCCTTATAGATTCACTGGGA pLKO.1 1989 3UTR 100% 0.660 0.924 N Sned1 n/a
2 TRCN0000099761 CCGGACTCTACGTGAACAATA pLKO.1 375 3UTR 100% 13.200 9.240 N Sned1 n/a
3 TRCN0000056124 CCACTACATTGGCAAATACAA pLKO.1 2077 3UTR 100% 5.625 3.938 N SNED1 n/a
4 TRCN0000099764 GTTAACACATTCCAAACTGTA pLKO.1 674 3UTR 100% 4.950 3.465 N Sned1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.