Transcript: Mouse XR_387160.3

PREDICTED: Mus musculus importin 9 (Ipo9), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ipo9 (226432)
Length:
4220
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387160.3
NBCI Gene record:
Ipo9 (226432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387160.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252615 TTGACTACAGTAGTTCGAAAT pLKO_005 2223 3UTR 100% 10.800 15.120 N Ipo9 n/a
2 TRCN0000252614 AGCATCCTTGATGGCCTAATT pLKO_005 1709 3UTR 100% 13.200 9.240 N Ipo9 n/a
3 TRCN0000252613 CACTCAGCTGGAACCTCTATT pLKO_005 2645 3UTR 100% 13.200 9.240 N Ipo9 n/a
4 TRCN0000252611 CCAAGATGATTCCAATGATAT pLKO_005 3032 3UTR 100% 13.200 9.240 N Ipo9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387160.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.