Transcript: Mouse XR_388313.2

PREDICTED: Mus musculus predicted gene, 25432 (Gm25432), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm25432 (102635008)
Length:
872
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388313.2
NBCI Gene record:
Gm25432 (102635008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388313.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276853 GAGGAGTGTGAGGAGGTAAAT pLKO_005 462 3UTR 100% 13.200 6.600 Y Nop56 n/a
2 TRCN0000193672 CCTAGCAAACAAATGCAGTAT pLKO.1 174 3UTR 100% 4.950 2.475 Y Nop56 n/a
3 TRCN0000173939 GCCTGAAGTTGCTGCTAACTT pLKO.1 725 3UTR 100% 0.563 0.281 Y Nop56 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388313.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.